Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCGGCAGATTGGAGAGAAAAGCCT[C/G]TTTACCAAGGAGCTTGAACATGCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 191350 MIM: 601772 MIM: 609806 MIM: 608549 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DPAGT1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DPAGT1 - dolichyl-phosphate N-acetylglucosaminephosphotransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
H2AFX - H2A histone family member X | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMBS - hydroxymethylbilane synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000190.3 | 717 | Silent Mutation | CTC,CTG | L,L 76 | NP_000181.2 | |
NM_001024382.1 | 717 | Silent Mutation | CTC,CTG | L,L 59 | NP_001019553.1 | |
NM_001258208.1 | 717 | Silent Mutation | CTC,CTG | L,L 76 | NP_001245137.1 | |
NM_001258209.1 | 717 | Silent Mutation | CTC,CTG | L,L 59 | NP_001245138.1 | |
XM_005271531.1 | 717 | Silent Mutation | CTC,CTG | L,L 59 | XP_005271588.1 | |
XM_005271532.1 | 717 | Silent Mutation | CTC,CTG | L,L 59 | XP_005271589.1 | |
XM_005271533.3 | 717 | Silent Mutation | CTC,CTG | L,L 58 | XP_005271590.1 | |
XM_011542796.1 | 717 | Silent Mutation | CTC,CTG | L,L 21 | XP_011541098.1 | |
XM_017017629.1 | 717 | Silent Mutation | CTC,CTG | L,L 59 | XP_016873118.1 |
VPS11 - VPS11, CORVET/HOPS core subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |