Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATGATCAGGTGGGTGGATAGTGT[C/T]AGTGCCATATGCAATGGTCATGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
NXPE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NXPE1 - neurexophilin and PC-esterase domain family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152315.3 | 1604 | Missense Mutation | AAC,GAC | N,D 384 | NP_689528.2 | |
XM_011542594.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540896.1 | |
XM_011542595.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540897.1 | |
XM_011542596.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540898.1 | |
XM_011542597.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540899.1 | |
XM_011542598.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540900.1 | |
XM_011542599.2 | 1604 | Missense Mutation | AAC,GAC | N,D 526 | XP_011540901.1 |
NXPE2 - neurexophilin and PC-esterase domain family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182495.5 | 1604 | Intron | NP_872301.2 | |||
XM_011542604.2 | 1604 | Intron | XP_011540906.1 | |||
XM_017017206.1 | 1604 | Intron | XP_016872695.1 | |||
XM_017017207.1 | 1604 | Intron | XP_016872696.1 | |||
XM_017017208.1 | 1604 | Intron | XP_016872697.1 | |||
XM_017017209.1 | 1604 | Intron | XP_016872698.1 | |||
XM_017017210.1 | 1604 | Intron | XP_016872699.1 | |||
XM_017017211.1 | 1604 | Intron | XP_016872700.1 | |||
XM_017017212.1 | 1604 | Intron | XP_016872701.1 |