Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGACGACAGCCGGGCTCGTGGCAA[C/G]CCCATGGAGCTCATCATTGGCAAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605555 MIM: 608794 | ||||||||||||||||||||
Literature Links: |
AIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AIP - aryl hydrocarbon receptor interacting protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302959.1 | 304 | UTR 5 | NP_001289888.1 | |||
NM_001302960.1 | 304 | Missense Mutation | AAC,AAG | N,K 58 | NP_001289889.1 | |
NM_003977.3 | 304 | Missense Mutation | AAC,AAG | N,K 58 | NP_003968.3 |
MIR6752 - microRNA 6752 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITPNM1 - phosphatidylinositol transfer protein membrane associated 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |