Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTTCTCCCGTAGGCCCTGAGCCT[A/G]TGCAATTATTTCGAGAGTCAAAATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609506 MIM: 604466 MIM: 615258 MIM: 604723 | ||||||||||||||||||||
Literature Links: |
CYP27B1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYP27B1 - cytochrome P450 family 27 subfamily B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL1 - methyltransferase like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005371.5 | 314 | Intron | NP_005362.3 | |||
NM_023033.3 | 314 | Intron | NP_075422.3 | |||
XM_005268873.2 | 314 | Intron | XP_005268930.1 | |||
XM_017019305.1 | 314 | Intron | XP_016874794.1 |
METTL21B - methyltransferase like 21B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015433.2 | 314 | Silent Mutation | CTA,CTG | L,L 63 | NP_056248.2 | |
NM_206914.1 | 314 | Silent Mutation | CTA,CTG | L,L 63 | NP_996797.1 |
TSFM - Ts translation elongation factor, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |