Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGTCAGCATTGAAAGAGGCTCCC[C/G]AGACTGGGGAAGAACGAGGTAGGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604441 MIM: 610410 MIM: 605773 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CIDEB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CIDEB - cell death-inducing DFFA-like effector b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DHRS1 - dehydrogenase/reductase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136050.2 | 330 | Intron | NP_001129522.1 | |||
NM_138452.2 | 330 | Intron | NP_612461.1 |
LTB4R2 - leukotriene B4 receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOP9 - NOP9 nucleolar protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286367.1 | 330 | Missense Mutation | CAG,GAG | Q,E 77 | NP_001273296.1 | |
NM_174913.2 | 330 | Missense Mutation | CAG,GAG | Q,E 77 | NP_777573.1 | |
XM_005267385.1 | 330 | Missense Mutation | CAG,GAG | Q,E 77 | XP_005267442.1 | |
XM_011536526.1 | 330 | Intron | XP_011534828.1 | |||
XM_011536527.2 | 330 | Missense Mutation | CAG,GAG | Q,E 77 | XP_011534829.1 |