Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGGCCTTCGTGAAAGGGGCCCAG[G/T]TGGACTTCAGCCAAGAACTGATCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615317 MIM: 602091 MIM: 601015 | ||||||||||||||||||||
Literature Links: |
ISCA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ISCA2 - iron-sulfur cluster assembly 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272007.1 | 416 | UTR 3 | NP_001258936.1 | |||
NM_194279.3 | 416 | Missense Mutation | GTG,TTG | V,L 121 | NP_919255.2 |
LTBP2 - latent transforming growth factor beta binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPC2 - NPC intracellular cholesterol transporter 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |