Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGTTATTGAAGCTTTTTCCACAC[C/T]CTTCACATTGATAGGGCTTTTCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609610 | ||||||||||||||||||||
Literature Links: |
ADAL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAL - adenosine deaminase like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUBGCP4 - tubulin gamma complex associated protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSCAN29 - zinc finger and SCAN domain containing 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152455.3 | 2884 | Missense Mutation | GAG,GGG | E,G 766 | NP_689668.3 | |
XM_006720401.3 | 2884 | Missense Mutation | GAG,GGG | E,G 766 | XP_006720464.1 | |
XM_011521266.2 | 2884 | Missense Mutation | GAG,GGG | E,G 766 | XP_011519568.1 | |
XM_017021949.1 | 2884 | Intron | XP_016877438.1 |