Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTCTGGAGTTCCTCGCCGAACTCT[G/T]TTAATCTCTGCTCCCAGCTCTATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609885 MIM: 602046 MIM: 605054 | ||||||||||||||||||||
Literature Links: |
ELL3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ELL3 - elongation factor for RNA polymerase II 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025165.2 | 1411 | Missense Mutation | AAA,AAC | K,N 336 | NP_079441.1 |
PDIA3 - protein disulfide isomerase family A member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SERF2 - small EDRK-rich factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |