Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACGATGCTGGATGCTCGCCTGC[A/C]ACGGCCACTCTCCGTCCCGGCCATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613797 MIM: 600787 | ||||||||||||||||||||
Literature Links: |
PRSS33 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRSS33 - protease, serine 33 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152891.2 | 245 | Missense Mutation | TGG,TTG | W,L 50 | NP_690851.2 | |
XM_011522451.2 | 245 | Missense Mutation | TGG,TTG | W,L 50 | XP_011520753.1 | |
XM_011522452.2 | 245 | Missense Mutation | TGG,TTG | W,L 50 | XP_011520754.1 |
PRSS41 - protease, serine 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCEB2 - transcription elongation factor B subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |