Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTGAGCCAGCTGCTGGCTGAGCC[A/G]GAGGTTCTGCTCGCTGAGCTCGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 617003 MIM: 615403 MIM: 605914 | ||||||||||||||||||||
Literature Links: |
BICDL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BICDL2 - BICD family like cargo adaptor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001103175.1 | 581 | Missense Mutation | CGG,TGG | R,W 159 | NP_001096645.1 | |
XM_005255135.4 | 581 | Missense Mutation | CGG,TGG | R,W 159 | XP_005255192.1 | |
XM_011522391.1 | 581 | Missense Mutation | CGG,TGG | R,W 94 | XP_011520693.1 |
HCFC1R1 - host cell factor C1 regulator 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100128770 - uncharacterized LOC100128770 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THOC6 - THO complex 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF12A - TNF receptor superfamily member 12A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |