Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTATTCTCTGTAGGAAGCAGACA[A/G]TGATCCAACAGGGGAAGCAGCAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606976 MIM: 605592 | ||||||||||||||||||||
Literature Links: |
COG4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COG4 - component of oligomeric golgi complex 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SF3B3 - splicing factor 3b subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012426.4 | 792 | Missense Mutation | AAT,AGT | N,S 194 | NP_036558.3 |
SNORD111 - small nucleolar RNA, C/D box 111 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD111B - small nucleolar RNA, C/D box 111B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |