Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCTTCCGCAATGGGAACCGCACG[C/T]ACCCGGAGGAGTACACAGGTGAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602844 MIM: 603816 MIM: 608012 MIM: 603895 | ||||||||||||||||||||
Literature Links: |
ARHGDIG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGDIG - Rho GDP dissociation inhibitor gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
AXIN1 - axin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDIA2 - protein disulfide isomerase family A member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006849.2 | 440 | Missense Mutation | CAC,TAC | H,Y 130 | NP_006840.2 |
RGS11 - regulator of G-protein signaling 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |