Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGTTCAGCTTCTCTATGTCTG[C/T]TTCTTTTGCCTTCTGGACTTCCTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 103870 MIM: 610271 MIM: 615562 | ||||||||||||||||||||
Literature Links: |
ALDOC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALDOC - aldolase, fructose-bisphosphate C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGS - phosphatidylinositol glycan anchor biosynthesis class S | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG5 - sperm associated antigen 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006461.3 | 3165 | Missense Mutation | ACA,GCA | T,A 1025 | NP_006452.3 |