Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGATTCTCATGGAACACATCCACA[A/G]GCTGAAGGCAGACAAGGCCCGCAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 114207 MIM: 180466 | ||||||||||||||||||||
Literature Links: |
CACNB1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACNB1 - calcium voltage-gated channel auxiliary subunit beta 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL19 - ribosomal protein L19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000981.3 | 842 | Intron | NP_000972.1 | |||
XM_005257564.3 | 842 | Missense Mutation | AAG,AGG | K,R 142 | XP_005257621.1 |
STAC2 - SH3 and cysteine rich domain 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |