Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGAGCTCTGGCAGCTGCATCTCCA[A/C]CTTCTCCCTCTGAAACAGATGGTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611425 MIM: 604111 MIM: 610969 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CNTROB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CNTROB - centrobin, centriole duplication and spindle assembly protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNAB3 - potassium voltage-gated channel subfamily A regulatory beta subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004732.3 | 743 | Missense Mutation | GTG,TTG | V,L 266 | NP_004723.2 | |
XM_011524068.1 | 743 | Missense Mutation | GTG,TTG | V,L 217 | XP_011522370.1 | |
XM_017025304.1 | 743 | Missense Mutation | GTG,TTG | V,L 217 | XP_016880793.1 | |
XM_017025305.1 | 743 | Missense Mutation | GTG,TTG | V,L 188 | XP_016880794.1 | |
XM_017025306.1 | 743 | Missense Mutation | GTG,TTG | V,L 188 | XP_016880795.1 |
LOC284023 - uncharacterized LOC284023 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAPPC1 - trafficking protein particle complex 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |