Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACTTTTCCTGAAGCGGACATTTT[A/C]CTTAAATCGGGTAACTGTCTCCAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603825 MIM: 610016 MIM: 613487 MIM: 610963 | ||||||||||||||||||||
Literature Links: |
HIC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HIC1 - hypermethylated in cancer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098202.1 | 27 | Missense Mutation | TTA,TTC | L,F 9 | NP_001091672.1 | |
NM_006497.3 | 27 | Intron | NP_006488.2 |
MIR132 - microRNA 132 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR212 - microRNA 212 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMG6 - SMG6, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |