Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGTCAGCACCAGCTCATACTCCTT[G/T]CCCTGCTGGGCCTCGGCCAAAAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608587 MIM: 602358 MIM: 604528 MIM: 604260 | ||||||||||||||||||||
Literature Links: |
GHDC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GHDC - GH3 domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142623.1 | 1275 | Silent Mutation | GGA,GGC | G,G 346 | NP_001136095.1 | |
NM_032484.4 | 1275 | Silent Mutation | GGA,GGC | G,G 346 | NP_115873.1 |
HCRT - hypocretin neuropeptide precursor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNH4 - potassium voltage-gated channel subfamily H member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAT5B - signal transducer and activator of transcription 5B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |