Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTCCAAGGCCTTCACGCTGACCAT[C/G]TCTGCCCTCTTTGTGACACCCAAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123830 MIM: 601964 | ||||||||||||||||||||
Literature Links: |
CNP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNP - 2',3'-cyclic nucleotide 3' phosphodiesterase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033133.4 | 1026 | Missense Mutation | ATC,ATG | I,M 286 | NP_149124.3 | |
XM_006721701.3 | 1026 | Missense Mutation | ATC,ATG | I,M 266 | XP_006721764.1 | |
XM_011524340.2 | 1026 | Missense Mutation | ATC,ATG | I,M 266 | XP_011522642.1 |
DNAJC7 - DnaJ heat shock protein family (Hsp40) member C7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC25 - tetratricopeptide repeat domain 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |