Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCTTCCAGAAGACATCTCCATAA[C/T]GCTGGGGCATGGGTCTGAGGCTCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611508 MIM: 603060 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAMTA2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CAMTA2 - calmodulin binding transcription activator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
INCA1 - inhibitor of CDK, cyclin A1 interacting protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001167985.1 | 592 | Missense Mutation | NP_001161457.1 | |||
NM_001167986.1 | 592 | Missense Mutation | NP_001161458.1 | |||
NM_001167987.1 | 592 | Missense Mutation | NP_001161459.1 | |||
NM_213726.2 | 592 | Missense Mutation | NP_998891.2 | |||
XM_005256627.3 | 592 | Missense Mutation | XP_005256684.1 | |||
XM_005256628.4 | 592 | Missense Mutation | XP_005256685.1 | |||
XM_005256629.1 | 592 | Missense Mutation | XP_005256686.1 | |||
XM_006721517.1 | 592 | Missense Mutation | XP_006721580.1 | |||
XM_006721518.2 | 592 | Missense Mutation | XP_006721581.1 | |||
XM_006721519.3 | 592 | Missense Mutation | XP_006721582.1 | |||
XM_011523832.2 | 592 | Missense Mutation | XP_011522134.1 | |||
XM_011523834.2 | 592 | Missense Mutation | XP_011522136.1 |
KIF1C - kinesin family member 1C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927979 - translation initiation factor IF-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |