Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAATATTTCAAATCACGGAGACCT[C/T]TCTTTACAGGAGGCCTCATCGGGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606272 MIM: 602836 MIM: 616484 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CTNS PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CTNS - cystinosin, lysosomal cystine transporter | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EMC6 - ER membrane protein complex subunit 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014764.2 | 476 | Missense Mutation | CTC,TTC | L,F 84 | NP_001014764.1 | |
NM_031298.3 | 476 | Missense Mutation | CTC,TTC | L,F 84 | NP_112588.1 |
P2RX5 - purinergic receptor P2X 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RX5-TAX1BP3 - P2RX5-TAX1BP3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAX1BP3 - Tax1 binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204698.1 | 476 | Intron | NP_001191627.1 | |||
NM_014604.3 | 476 | Intron | NP_055419.1 |