Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACCTTAGCCCCCGGTTTGATGTGG[A/T]TCTGGTCCACACCACCCAGGATTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604556 MIM: 134795 | ||||||||||||||||||||
Literature Links: |
DYRK1B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DYRK1B - dual specificity tyrosine phosphorylation regulated kinase 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBL - fibrillarin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001436.3 | 359 | Missense Mutation | AAC,ATC | N,I 155 | NP_001427.2 | |
XM_005258651.2 | 359 | Missense Mutation | AAC,ATC | N,I 154 | XP_005258708.1 | |
XM_011526623.2 | 359 | Missense Mutation | AAC,ATC | N,I 98 | XP_011524925.1 |
MIR6719 - microRNA 6719 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |