Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCATCTCCATGCAAGCCATCCTTA[C/T]GGGTCGCGCCCCGGGCTGCACGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609966 MIM: 609293 | ||||||||||||||||||||
Literature Links: |
GGN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GGN - gametogenetin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152657.3 | 1863 | Missense Mutation | NP_689870.3 | |||
XM_005258619.4 | 1863 | Missense Mutation | XP_005258676.1 | |||
XM_011526603.2 | 1863 | Missense Mutation | XP_011524905.1 | |||
XM_017026451.1 | 1863 | Missense Mutation | XP_016881940.1 |
PSMD8 - proteasome 26S subunit, non-ATPase 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPRED3 - sprouty related EVH1 domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |