Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTTGGGCCCTGCAGAGCGTTGAGG[G/T]TGAGCAGCATGAGAAGGCGGTGGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612331 MIM: 603144 MIM: 180740 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C19orf73 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C19orf73 - chromosome 19 open reading frame 73 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018111.2 | 352 | Intron | NP_060581.2 |
LIN7B - lin-7 homolog B, crumbs cell polarity complex component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308419.1 | 352 | Missense Mutation | GGT,GTT | G,V 80 | NP_001295348.1 | |
NM_022165.2 | 352 | Missense Mutation | GGT,GTT | G,V 150 | NP_071448.1 | |
XM_006723323.3 | 352 | Missense Mutation | GGT,GTT | G,V 126 | XP_006723386.1 | |
XM_017027131.1 | 352 | Missense Mutation | GTG,TTG | V,L 96 | XP_016882620.1 |
PPFIA3 - PTPRF interacting protein alpha 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNRNP70 - small nuclear ribonucleoprotein U1 subunit 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |