Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTCTTGACTCTTTCTCAGAACTGT[A/G]TGCCTCTGCTCAGAAGCCCCCCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603183 MIM: 601703 | ||||||||||||||||||||
Literature Links: |
PPM1N PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PPM1N - protein phosphatase, Mg2+/Mn2+ dependent 1N (putative) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080401.1 | 1064 | Missense Mutation | TAT,TGT | Y,C 355 | NP_001073870.1 | |
XM_011526474.2 | 1064 | Missense Mutation | TAT,TGT | Y,C 355 | XP_011524776.1 |
RTN2 - reticulon 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VASP - vasodilator-stimulated phosphoprotein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |