Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTCAGCGTTATCAGCCTTGCAGC[A/G]GGTTTCAAAGAAGTACTGGCGGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608826 MIM: 176268 MIM: 162662 | ||||||||||||||||||||
Literature Links: |
CGB7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CGB7 - chorionic gonadotropin beta subunit 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNA7 - potassium voltage-gated channel subfamily A member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NTF4 - neurotrophin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006179.4 | 680 | Missense Mutation | NP_006170.1 | |||
XM_005258962.3 | 680 | Missense Mutation | XP_005259019.1 | |||
XM_006723232.3 | 680 | Intron | XP_006723295.1 | |||
XM_011527008.2 | 680 | Intron | XP_011525310.1 | |||
XM_011527009.2 | 680 | Intron | XP_011525311.1 | |||
XM_011527010.2 | 680 | Intron | XP_011525312.1 |