Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGTAACCACTTTTCTCAATGATC[C/T]TCATGTATCGGACCTGGAAGGGAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607309 MIM: 600927 | ||||||||||||||||||||
Literature Links: |
AP1M2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AP1M2 - adaptor related protein complex 1 mu 2 subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300887.1 | 1271 | Missense Mutation | AAG,AGG | K,R 398 | NP_001287816.1 | |
NM_005498.4 | 1271 | Missense Mutation | AAG,AGG | K,R 396 | NP_005489.2 |
CDKN2D - cyclin dependent kinase inhibitor 2D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KRI1 - KRI1 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |