Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGGAGAGGTGGCTGGGTTCCCTAC[A/G]GCGGCCCTCCCTGGTGCACGGGTAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 134629 MIM: 609712 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FDPS PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FDPS - farnesyl diphosphate synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135821.1 | 311 | Missense Mutation | CAG,CGG | Q,R 31 | NP_001129293.1 | |
NM_001135822.1 | 311 | Intron | NP_001129294.1 | |||
NM_001242824.1 | 311 | Intron | NP_001229753.1 | |||
NM_001242825.1 | 311 | Intron | NP_001229754.1 | |||
NM_002004.3 | 311 | Missense Mutation | CAG,CGG | Q,R 31 | NP_001995.1 | |
XM_005244962.1 | 311 | Intron | XP_005245019.1 | |||
XM_005244963.1 | 311 | Intron | XP_005245020.1 |
LOC105371451 - uncharacterized LOC105371451 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKLR - pyruvate kinase, liver and RBC | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |