Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTGGAAGTCCGTCTATGTCGCCTG[A/C]CCCTGGAAAGAAAAAATAATCCAAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611843 MIM: 607390 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MRPL37 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MRPL37 - mitochondrial ribosomal protein L37 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSBP3 - single stranded DNA binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001009955.3 | 1336 | Missense Mutation | GCA,TCA | A,S 310 | NP_001009955.1 | |
NM_018070.4 | 1336 | Missense Mutation | GCA,TCA | A,S 317 | NP_060540.2 | |
NM_145716.3 | 1336 | Missense Mutation | GCA,TCA | A,S 337 | NP_663768.1 | |
XM_006710545.3 | 1336 | Missense Mutation | GCA,TCA | A,S 290 | XP_006710608.1 | |
XM_017000897.1 | 1336 | Missense Mutation | GCA,TCA | A,S 227 | XP_016856386.1 | |
XM_017000898.1 | 1336 | Missense Mutation | GCA,TCA | A,S 227 | XP_016856387.1 | |
XM_017000899.1 | 1336 | Missense Mutation | GCA,TCA | A,S 200 | XP_016856388.1 |
SSBP3-AS1 - SSBP3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |