Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGAAGATCTAGAACAGCTCAAGTC[C/G]GCCTGCAAGGAAGACATCCCCAGCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 114250 MIM: 615820 MIM: 603434 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CASQ1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CASQ1 - calsequestrin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DCAF8 - DDB1 and CUL4 associated factor 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC729867 - uncharacterized LOC729867 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PEA15 - phosphoprotein enriched in astrocytes 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297576.1 | 281 | Silent Mutation | TCC,TCG | S,S 46 | NP_001284505.1 | |
NM_001297577.1 | 281 | Silent Mutation | TCC,TCG | S,S 25 | NP_001284506.1 | |
NM_001297578.1 | 281 | Silent Mutation | TCC,TCG | S,S 25 | NP_001284507.1 | |
NM_003768.4 | 281 | Silent Mutation | TCC,TCG | S,S 25 | NP_003759.1 | |
XM_006711599.2 | 281 | Silent Mutation | TCC,TCG | S,S 25 | XP_006711662.1 |