Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGCAGGACAGGAAGACACAGTAC[C/T]CTTGGAAGTCCACCTCGTTGTCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 176992 MIM: 114210 MIM: 176991 MIM: 114110 | ||||||||||||||||||||
Literature Links: |
LOC101928034 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101928034 - uncharacterized LOC101928034 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A3 - S100 calcium binding protein A3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A4 - S100 calcium binding protein A4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002961.2 | 339 | Missense Mutation | GAG,GGG | E,G 74 | NP_002952.1 | |
NM_019554.2 | 339 | Missense Mutation | GAG,GGG | E,G 74 | NP_062427.1 |
S100A5 - S100 calcium binding protein A5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002962.1 | 339 | Intron | NP_002953.2 | |||
XM_011509860.2 | 339 | Intron | XP_011508162.1 | |||
XM_017002029.1 | 339 | Intron | XP_016857518.1 | |||
XM_017002030.1 | 339 | Intron | XP_016857519.1 | |||
XM_017002031.1 | 339 | Intron | XP_016857520.1 | |||
XM_017002032.1 | 339 | Intron | XP_016857521.1 |
S100A6 - S100 calcium binding protein A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |