Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTGTGATTCATAGGTACTGGAAG[A/T]TGCTCACAGAGATGCCAACCTGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610339 | ||||||||||||||||||||
Literature Links: |
C1orf50 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1orf50 - chromosome 1 open reading frame 50 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024097.3 | 360 | Missense Mutation | GAT,GTT | D,V 98 | NP_077002.2 |
LOC105378683 - uncharacterized LOC105378683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P3H1 - prolyl 3-hydroxylase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |