Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGTGGCCAACCTTCTGCTGTGTA[C/T]GTATGCCAAGGAGACCGTGGGCTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610389 MIM: 612942 MIM: 605440 | ||||||||||||||||||||
Literature Links: |
LAMTOR2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LAMTOR2 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145264.1 | 442 | Intron | NP_001138736.1 | |||
NM_014017.3 | 442 | Missense Mutation | ACG,ATG | T,M 93 | NP_054736.1 |
RAB25 - RAB25, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBQLN4 - ubiquilin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |