Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTTCCCCATGTCCAAGGCCTTGG[C/T]TTTCCTCATCATTTCCAGCGTATAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 147485 | ||||||||||||||||||||
Literature Links: |
GPBP1L1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPBP1L1 - GC-rich promoter binding protein 1 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IPP - intracisternal A particle-promoted polypeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM69 - transmembrane protein 69 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016486.3 | Intron | NP_057570.2 |