Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGGTAGCCTCTGAGCTAGGCTAT[C/G]TGTTCCAAGCCATCACCCTTACCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 613521 | ||||||||||||||||||||
Literature Links: |
HECTD3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HECTD3 - HECT domain E3 ubiquitin protein ligase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UROD - uroporphyrinogen decarboxylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000374.4 | 507 | Missense Mutation | CTG,GTG | L,V 134 | NP_000365.3 | |
XM_005271169.1 | 507 | Missense Mutation | CTG,GTG | L,V 62 | XP_005271226.1 | |
XM_005271170.1 | 507 | Missense Mutation | CTG,GTG | L,V 62 | XP_005271227.1 |
ZSWIM5 - zinc finger SWIM-type containing 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |