Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACTATCAACATCACCCTCCTCCT[A/C]CACCTCCTCTTCCTCCCCCAATTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 116949 MIM: 117140 MIM: 610674 | ||||||||||||||||||||
Literature Links: |
CDC25B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDC25B - cell division cycle 25B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CENPB - centromere protein B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001810.5 | 1552 | Nonsense Mutation | GAG,TAG | E,* 449 | NP_001801.1 |
SPEF1 - sperm flagellar 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |