Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGACACTAGAGTCTGAGGAAGATA[C/G]AGGGGAAGGGAAGTTAAATCCGTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600909 MIM: 603294 | ||||||||||||||||||||
Literature Links: |
LSS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LSS - lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCM3AP - minichromosome maintenance complex component 3 associated protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003906.4 | 6286 | Silent Mutation | CTC,CTG | L,L 1902 | NP_003897.2 | |
XM_005261203.4 | 6286 | Silent Mutation | CTC,CTG | L,L 1902 | XP_005261260.1 | |
XM_005261204.4 | 6286 | Silent Mutation | CTC,CTG | L,L 1902 | XP_005261261.1 | |
XM_005261205.3 | 6286 | Silent Mutation | CTC,CTG | L,L 1902 | XP_005261262.1 |
MCM3AP-AS1 - MCM3AP antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |