Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCAGGTGCAGCTGCCCAAGAAGC[C/G]ACTGGTCCCAGAAATGCGGCCAGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607551 | ||||||||||||||||||||
Literature Links: |
CCDC116 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC116 - coiled-coil domain containing 116 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152612.2 | 404 | Missense Mutation | CCA,CGA | P,R 31 | NP_689825.2 | |
XM_006724159.2 | 404 | Missense Mutation | CCA,CGA | P,R 97 | XP_006724222.1 | |
XM_011529984.2 | 404 | UTR 5 | XP_011528286.1 | |||
XM_011529985.1 | 404 | Missense Mutation | CCA,CGA | P,R 97 | XP_011528287.1 |
SDF2L1 - stromal cell derived factor 2 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YDJC - YdjC homolog (bacterial) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |