Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAAAGCCCTGCCGGCCTCCAGGT[G/T]CTCAACGATTACCTGGCGGACAAGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600655 MIM: 157655 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EEF1B2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EEF1B2 - eukaryotic translation elongation factor 1 beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037663.1 | 428 | Intron | NP_001032752.1 | |||
NM_001959.3 | 428 | Silent Mutation | GTG,GTT | V,V 14 | NP_001950.1 | |
NM_021121.3 | 428 | Intron | NP_066944.1 |
NDUFS1 - NADH:ubiquinone oxidoreductase core subunit S1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199981.1 | 428 | Intron | NP_001186910.1 | |||
NM_001199982.1 | 428 | Intron | NP_001186911.1 | |||
NM_001199983.1 | 428 | Intron | NP_001186912.1 | |||
NM_001199984.1 | 428 | Intron | NP_001186913.1 | |||
NM_005006.6 | 428 | Intron | NP_004997.4 | |||
XM_017004188.1 | 428 | Intron | XP_016859677.1 |
SNORA41 - small nucleolar RNA, H/ACA box 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD51 - small nucleolar RNA, C/D box 51 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |