Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGGCGCCAGGTACTTCTGGAAGAC[A/G]AAGCGCCGCTCCAGCTCCAGCACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607164 MIM: 610231 | ||||||||||||||||||||
Literature Links: |
LBX2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LBX2 - ladybird homeobox 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001009812.1 | 757 | Silent Mutation | TTC,TTT | F,F 100 | NP_001009812.1 | |
NM_001282430.1 | 757 | Silent Mutation | TTC,TTT | F,F 104 | NP_001269359.1 |
LBX2-AS1 - LBX2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCGF1 - polycomb group ring finger 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC31 - tetratricopeptide repeat domain 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |