Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACATCAAGTCTTACGAAAAGGAAA[A/G]GGCCAGGTAAAATCATCTTTGTATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600655 MIM: 157655 | ||||||||||||||||||||
Literature Links: |
EEF1B2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EEF1B2 - eukaryotic translation elongation factor 1 beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037663.1 | 583 | Intron | NP_001032752.1 | |||
NM_001959.3 | 583 | Missense Mutation | AAG,AGG | K,R 66 | NP_001950.1 | |
NM_021121.3 | 583 | Intron | NP_066944.1 |
NDUFS1 - NADH:ubiquinone oxidoreductase core subunit S1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA41 - small nucleolar RNA, H/ACA box 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD51 - small nucleolar RNA, C/D box 51 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |