Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAAAGTGCCTCCTTGAAGCCCTG[C/G]ACCGATAGCTTCCGTCCATGGTACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606992 MIM: 606671 | ||||||||||||||||||||
Literature Links: |
IP6K2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IP6K2 - inositol hexakisphosphate kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005909.2 | 1098 | Silent Mutation | GTC,GTG | V,V 282 | NP_001005909.1 | |
NM_001005910.2 | 1098 | Intron | NP_001005910.1 | |||
NM_001005911.2 | 1098 | Intron | NP_001005911.1 | |||
NM_001146178.2 | 1098 | Intron | NP_001139650.1 | |||
NM_001146179.2 | 1098 | Intron | NP_001139651.1 | |||
NM_001190316.1 | 1098 | Intron | NP_001177245.1 | |||
NM_001190317.1 | 1098 | Intron | NP_001177246.1 | |||
NM_016291.3 | 1098 | Silent Mutation | GTC,GTG | V,V 282 | NP_057375.2 | |
XM_006713199.3 | 1098 | Silent Mutation | GTC,GTG | V,V 341 | XP_006713262.1 | |
XM_006713200.1 | 1098 | Silent Mutation | GTC,GTG | V,V 340 | XP_006713263.1 | |
XM_006713201.1 | 1098 | Silent Mutation | GTC,GTG | V,V 337 | XP_006713264.1 | |
XM_006713202.1 | 1098 | Silent Mutation | GTC,GTG | V,V 336 | XP_006713265.1 | |
XM_011533816.1 | 1098 | Silent Mutation | GTC,GTG | V,V 336 | XP_011532118.1 | |
XM_011533817.1 | 1098 | Silent Mutation | GTC,GTG | V,V 244 | XP_011532119.1 | |
XM_011533818.1 | 1098 | Silent Mutation | GTC,GTG | V,V 244 | XP_011532120.1 | |
XM_011533822.1 | 1098 | Intron | XP_011532124.1 | |||
XM_011533823.1 | 1098 | Intron | XP_011532125.1 | |||
XM_017006583.1 | 1098 | Silent Mutation | GTC,GTG | V,V 282 | XP_016862072.1 | |
XM_017006584.1 | 1098 | Silent Mutation | GTC,GTG | V,V 282 | XP_016862073.1 | |
XM_017006585.1 | 1098 | Silent Mutation | GTC,GTG | V,V 282 | XP_016862074.1 | |
XM_017006586.1 | 1098 | Silent Mutation | GTC,GTG | V,V 244 | XP_016862075.1 | |
XM_017006587.1 | 1098 | Silent Mutation | GTC,GTG | V,V 244 | XP_016862076.1 | |
XM_017006588.1 | 1098 | Intron | XP_016862077.1 | |||
XM_017006589.1 | 1098 | Intron | XP_016862078.1 | |||
XM_017006590.1 | 1098 | Intron | XP_016862079.1 | |||
XM_017006591.1 | 1098 | Intron | XP_016862080.1 | |||
XM_017006592.1 | 1098 | Intron | XP_016862081.1 | |||
XM_017006593.1 | 1098 | Intron | XP_016862082.1 |
NCKIPSD - NCK interacting protein with SH3 domain | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |