Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGTAAGGAAGCCATAGGGGTCCT[C/T]TGCAGCCCATTCCACAACATACTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609653 | ||||||||||||||||||||
Literature Links: |
CTC-436P18.1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTC-436P18.1 - uncharacterized LOC101928630 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFAF2 - NADH:ubiquinone oxidoreductase complex assembly factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMIM15 - small integral membrane protein 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048249.3 | 476 | Missense Mutation | AAG,GAG | K,E 17 | NP_001041714.1 |