Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATCAGACCATGACTACCTTCACC[C/T]GGAACATCAACCACGCCCGGCTGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609450 MIM: 606681 MIM: 605733 MIM: 612415 | ||||||||||||||||||||
Literature Links: |
MXD3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MXD3 - MAX dimerization protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142935.1 | Intron | NP_001136407.1 | ||||
NM_031300.3 | Intron | NP_112590.1 |
NSD1 - nuclear receptor binding SET domain protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRELID1 - PRELI domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271828.1 | Intron | NP_001258757.1 | ||||
NM_013237.3 | Intron | NP_037369.1 |
RAB24 - RAB24, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |