Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCTCCTCCACCGGTAGTGCTCG[C/T]ACCAGCACCTCCCGCACGGCCCGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611179 | ||||||||||||||||||||
Literature Links: |
LOC107984115 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107984115 - laforin-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHROOM1 - shroom family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001172700.1 | 2417 | Silent Mutation | GTA,GTG | V,V 778 | NP_001166171.1 | |
NM_133456.2 | 2417 | Silent Mutation | GTA,GTG | V,V 773 | NP_597713.2 | |
XM_005271885.4 | 2417 | Silent Mutation | GTA,GTG | V,V 778 | XP_005271942.1 | |
XM_005271886.3 | 2417 | Silent Mutation | GTA,GTG | V,V 778 | XP_005271943.1 | |
XM_006714534.3 | 2417 | Intron | XP_006714597.1 | |||
XM_011543167.2 | 2417 | Silent Mutation | GTA,GTG | V,V 778 | XP_011541469.1 |
SOWAHA - sosondowah ankyrin repeat domain family member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |