Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGCCACAGGTGGATGGGCTGCCC[A/G]GAGCATGATGAGTCCACCTCGCTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606512 MIM: 608144 | ||||||||||||||||||||
Literature Links: |
PACSIN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PACSIN1 - protein kinase C and casein kinase substrate in neurons 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPDEF - SAM pointed domain containing ETS transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252294.1 | 1861 | Silent Mutation | TCC,TCT | S,S 229 | NP_001239223.1 | |
NM_012391.2 | 1861 | Silent Mutation | TCC,TCT | S,S 245 | NP_036523.1 | |
XM_005248988.4 | 1861 | Silent Mutation | TCC,TCT | S,S 317 | XP_005249045.2 | |
XM_011514457.2 | 1861 | Intron | XP_011512759.1 |