Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATGGGTGGTTCTCCCTCCAGGAAA[C/G]GGGGAGGAGGGACCAGGACCTGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615556 MIM: 603405 | ||||||||||||||||||||
Literature Links: |
ATAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATAT1 - alpha tubulin acetyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C6orf136 - chromosome 6 open reading frame 136 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001109938.2 | 463 | Missense Mutation | AAC,AAG | N,K 90 | NP_001103408.1 | |
NM_001161376.1 | 463 | Missense Mutation | AAC,AAG | N,K 271 | NP_001154848.1 | |
NM_145029.3 | 463 | Intron | NP_659466.2 | |||
XM_011514384.1 | 463 | UTR 5 | XP_011512686.1 |
DHX16 - DEAH-box helicase 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |