Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGACAGGAGGGCAGGAGCAGGGAG[G/T]GGGCAATCAGGATGGTCAGGGGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609097 | ||||||||||||||||||||
Literature Links: |
FBXO24 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXO24 - F-box protein 24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001163499.1 | 424 | Intron | NP_001156971.1 | |||
NM_012172.4 | 424 | Missense Mutation | GGG,TGG | G,W 24 | NP_036304.2 | |
NM_033506.2 | 424 | Intron | NP_277041.1 | |||
XM_005250259.3 | 424 | Missense Mutation | GGG,TGG | G,W 24 | XP_005250316.1 | |
XM_011516022.1 | 424 | Intron | XP_011514324.1 | |||
XM_011516023.2 | 424 | UTR 5 | XP_011514325.1 | |||
XM_017011961.1 | 424 | Intron | XP_016867450.1 |
LRCH4 - leucine rich repeats and calponin homology domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCOLCE-AS1 - PCOLCE antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |