Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCACGTAGCATGCCAGCACCATGG[C/T]AATCCCCGAGATGCTCCCCTTCTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603052 | ||||||||||||||||||||
Literature Links: |
ATP5J2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5J2 - ATP synthase, H+ transporting, mitochondrial Fo complex subunit F2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003713.2 | 241 | Missense Mutation | ACC,GCC | T,A 61 | NP_001003713.1 | |
NM_001003714.2 | 241 | Intron | NP_001003714.1 | |||
NM_001039178.2 | 241 | Intron | NP_001034267.1 | |||
NM_004889.3 | 241 | Missense Mutation | ACC,GCC | T,A 67 | NP_004880.1 |
ATP5J2-PTCD1 - ATP5J2-PTCD1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198879.1 | 241 | Intron | NP_001185808.1 |
CPSF4 - cleavage and polyadenylation specific factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |