Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCAGTTGACCAACCTCTTTGACT[A/C]TCTGAAGAAAGAGAATGTGATGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616904 MIM: 152760 | ||||||||||||||||||||
Literature Links: |
DOCK5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DOCK5 - dedicator of cytokinesis 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GNRH1 - gonadotropin releasing hormone 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000825.3 | 1853 | Missense Mutation | NP_000816.4 | |||
NM_001083111.1 | 1853 | Missense Mutation | NP_001076580.1 |
KCTD9 - potassium channel tetramerization domain containing 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |