Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGTCTCCAAAGATCTTGTGCATTT[C/T]CGAGTAGTACACAACCTGGGGGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606396 MIM: 607359 | ||||||||||||||||||||
Literature Links: |
BIN3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BIN3 - bridging integrator 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018688.4 | 813 | Missense Mutation | AAA,GAA | K,E 211 | NP_061158.1 | |
XM_005273573.3 | 813 | Missense Mutation | AAA,GAA | K,E 163 | XP_005273630.1 | |
XM_011544586.2 | 813 | Missense Mutation | AAA,GAA | K,E 157 | XP_011542888.1 | |
XM_011544587.1 | 813 | Intron | XP_011542889.1 |
CCAR2 - cell cycle and apoptosis regulator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |